View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13310_low_20 (Length: 294)

Name: NF13310_low_20
Description: NF13310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13310_low_20
NF13310_low_20
[»] chr5 (2 HSPs)
chr5 (9-192)||(929746-929929)
chr5 (205-239)||(929642-929676)
[»] scaffold0191 (1 HSPs)
scaffold0191 (21-83)||(24919-24981)


Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 9 - 192
Target Start/End: Complemental strand, 929929 - 929746
Alignment:
Q  9 cagaacctgtgctctcaatttttgcaacattgtggtatcaaaggtgggaagaaaggtaggaaattctcacatttatcgtgtatggatggatacaatctaa 108  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  929929 cagaacccgtgctctcaatttttgcaacattgtggtatcaaaggtggtaagaaaggtaggaaattctcacatttatcgtgtatggatggatacaatctaa 929830  T
Q  109 tgcattttgctaggtagaaatcaaattatctttgaaggaaactcaatgaatgtaagcggcatagtgtcgcatattaaaatggtt 192  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  929829 tgcatttttctaggtagaaatcaaattatctttgaaggaaactcaatgaatgtaagcggcatagtgtcgcatattaaaatggtt 929746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 205 - 239
Target Start/End: Complemental strand, 929676 - 929642
Alignment:
Q  205 ggatggaatcgaggactaaaccgttaaacggttat 239  Q
    ||||||||||||||||||||||||||||| |||||    
T  929676 ggatggaatcgaggactaaaccgttaaactgttat 929642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0191 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0191
Description:

Target: scaffold0191; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 24919 - 24981
Alignment:
Q  21 tctcaatttttgcaacattgtggtatcaaaggtgggaagaaaggtaggaaattctcacattta 83  Q
    ||||| || |||||||| ||||||||||||||||| ||||||| |||||||| ||||||||||    
T  24919 tctcatttattgcaacactgtggtatcaaaggtggtaagaaagataggaaatgctcacattta 24981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University