View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13305_low_23 (Length: 212)

Name: NF13305_low_23
Description: NF13305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13305_low_23
NF13305_low_23
[»] chr4 (1 HSPs)
chr4 (18-195)||(53557869-53558046)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 53558046 - 53557869
Alignment:
Q  18 catagggttgttattagagttttgaaggctaatttggatcattttttcttgagaaggatgcaactttggccaaactagtgcagcagggttattactgtaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  53558046 catagggttgttattagagttttgaaggctaatttggatcattttttcttgagaaggatgcaactttggccaaactagtgcagcagggttattattgtaa 53557947  T
Q  118 aaagacaaagggttttgaaggctttgaagttgcatatgaagttgaagtctctcaagagctgagctacttaatgaattt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53557946 aaagacaaagggttttgaaggctttgaagttgcatatgaagttgaagtctctcaagagctgagctacttaatgaattt 53557869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University