View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13295_low_70 (Length: 221)

Name: NF13295_low_70
Description: NF13295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13295_low_70
NF13295_low_70
[»] chr8 (1 HSPs)
chr8 (22-113)||(2095474-2095565)


Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 2095565 - 2095474
Alignment:
Q  22 aagaacaaagaaaggttggtggaagagtggctagaagaagtttaaatcctgtcttgaaagaagttaaaaagcaaggtgtccggctacgactt 113  Q
    |||||||||||| ||||||||||||||||||||||||||||| |  |||||||||| |||| ||||||||||||||||||||||| ||||||    
T  2095565 aagaacaaagaagggttggtggaagagtggctagaagaagttcatgtcctgtcttggaagaggttaaaaagcaaggtgtccggcttcgactt 2095474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University