View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13292_low_27 (Length: 205)

Name: NF13292_low_27
Description: NF13292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13292_low_27
NF13292_low_27
[»] chr6 (2 HSPs)
chr6 (18-159)||(28735447-28735588)
chr6 (126-188)||(28730842-28730904)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 28735447 - 28735588
Alignment:
Q  18 gaagtcgggctaaatctactgcaaatacttttaatatgatgcaattttttcttatgttggagattgtattttgcaggagaaagcacacagtgatttctac 117  Q
    |||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  ||||||| |    
T  28735447 gaagtcaggataaatctactgcaaatacttttcatatgatgcaattttttcttatgttggagattgtattttgcaggagaaagcactcaaagatttctgc 28735546  T
Q  118 ttatttgataggtaaagatgcatacttaatattcccatggtt 159  Q
    | |||||||||| |||||||| ||||||||||| ||| ||||    
T  28735547 taatttgatagggaaagatgcctacttaatatttccaaggtt 28735588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 126 - 188
Target Start/End: Original strand, 28730842 - 28730904
Alignment:
Q  126 taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28730842 taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc 28730904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University