View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13283_high_3 (Length: 257)

Name: NF13283_high_3
Description: NF13283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13283_high_3
NF13283_high_3
[»] chr7 (1 HSPs)
chr7 (14-244)||(47583029-47583259)


Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 47583029 - 47583259
Alignment:
Q  14 aggggaaaatatcaaattgtattagattagacatgggaaaattagcggtattaatactggtgtgtttgattgcagcaacgattgcagaacaatgcggtag 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47583029 aggggaaaatatcaaattgtattagattagacatgggaaaattagcggtattaatactggtgtgtttgattgcagcaacgattgcagaacaatgcggtag 47583128  T
Q  114 acaagctggaggaaaaacatgtccaaacaacctttgttgcagccaatacggttactgtggtaccacagatgaatactgtggtccgaactgtcagagtaac 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47583129 acaagctggaggaaaaacatgtccaaacaacctttgttgcagccaatacggttactgtggtaccacagatgaatactgtggtccgaactgtcagagtaac 47583228  T
Q  214 tgtcatggcagtagtggtggtggtgaaagtg 244  Q
    |||||||||||||||||||||||||||||||    
T  47583229 tgtcatggcagtagtggtggtggtgaaagtg 47583259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University