View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1327_low_14 (Length: 319)

Name: NF1327_low_14
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1327_low_14
NF1327_low_14
[»] chr1 (1 HSPs)
chr1 (96-319)||(24818093-24818332)
[»] chr8 (1 HSPs)
chr8 (127-188)||(40868651-40868712)
[»] chr7 (1 HSPs)
chr7 (127-188)||(41875511-41875572)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 96 - 319
Target Start/End: Original strand, 24818093 - 24818332
Alignment:
Q  96 caagatggtacacttttcggaaccacaataaatgcagggatcccccttatctttgctgccaaagataatgcagcagcatggttcccgctgattgtagaaa 195  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  24818093 caagatggtgcacttttcggaaccacaataaatgcagggatcccccttatctttgctgccaaagataatgcagcagcatggttcccactgattgtagaaa 24818192  T
Q  196 acag------------------aaataaatatacttcaccaaatggttgttcaaatataattacggcataaacacacacctgctatgtgtagttactcct 277  Q
    ||||                  |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||||||||||||    
T  24818193 acagaaataaatatacttcatcaaataaatatacttcaccaaatggttgttcaaatataattacggcataa--acacacctgctgtgtgtagttactcct 24818290  T
Q  278 ttagaagcctcttcatcggtcagagagagaacagcgttgcat 319  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24818291 ttagaagcctcttcatcggtcagagagagaacagcgttgcat 24818332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 188
Target Start/End: Original strand, 40868651 - 40868712
Alignment:
Q  127 atgcagggatcccccttatctttgctgccaaagataatgcagcagcatggttcccgctgatt 188  Q
    ||||||||||||||| ||  |||||||||| ||  ||||||||||||||||| || ||||||    
T  40868651 atgcagggatcccccgtagttttgctgccagagccaatgcagcagcatggtttccactgatt 40868712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 188
Target Start/End: Complemental strand, 41875572 - 41875511
Alignment:
Q  127 atgcagggatcccccttatctttgctgccaaagataatgcagcagcatggttcccgctgatt 188  Q
    |||||||||| |||||||  |||||||||||||  |||||||||||||| || || ||||||    
T  41875572 atgcagggattccccttagttttgctgccaaagccaatgcagcagcatgatttccactgatt 41875511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University