View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13277_low_3 (Length: 440)

Name: NF13277_low_3
Description: NF13277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13277_low_3
NF13277_low_3
[»] chr4 (2 HSPs)
chr4 (9-119)||(2565927-2566037)
chr4 (348-425)||(2565828-2565906)


Alignment Details
Target: chr4 (Bit Score: 83; Significance: 4e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 9 - 119
Target Start/End: Complemental strand, 2566037 - 2565927
Alignment:
Q  9 atagaaccataaatttatgatatggttttatagtctagttccttaattcaagtagcactctatgttttgtatcagtaacttaaatcaatgctttgatagt 108  Q
    |||||| ||| ||||||||||||| ||| | ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  2566037 atagaagcatgaatttatgatatgatttgaaagtctagtttcttaattcaagtggcactctatgttttgtatcagtaacttaaatcaatgctttgatagt 2565938  T
Q  109 tttgttagata 119  Q
    |||||||||||    
T  2565937 tttgttagata 2565927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 348 - 425
Target Start/End: Complemental strand, 2565906 - 2565828
Alignment:
Q  348 ttgcttgaacacatactataaaatttcatctcatttcatttgat-ataatatagaattttcttttacaaatatgtgaat 425  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  2565906 ttgcttgaacacatactataaaatttcatctcatttcatttgatgataatatagaattttcttttacaaatatgtgaat 2565828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University