View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1326_low_13 (Length: 437)

Name: NF1326_low_13
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1326_low_13
NF1326_low_13
[»] chr7 (2 HSPs)
chr7 (197-312)||(39322331-39322446)
chr7 (126-174)||(39322444-39322492)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 197 - 312
Target Start/End: Complemental strand, 39322446 - 39322331
Alignment:
Q  197 tttgtacactgaccataatatgtgactgattttattttttcgaacaggaatttgcatattaatataatacgctactttgaaattcttgaaggggaaattg 296  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39322446 tttgtacactgaccataatatgtgaatgattttattttttcgaacaggaatttgcatattaatataatacgctactttgaaattcttgaaggggaaattg 39322347  T
Q  297 tttatcaactattatt 312  Q
    ||||||||||||||||    
T  39322346 tttatcaactattatt 39322331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 39322492 - 39322444
Alignment:
Q  126 acctgtgtgccatcctggaactttacttttgcatatttgtaaattattt 174  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||    
T  39322492 acctgtgtgccatcctggaactttacttttgcttatttgtaaattattt 39322444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University