View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1325R-Insertion-15 (Length: 176)

Name: NF1325R-Insertion-15
Description: NF1325R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1325R-Insertion-15
NF1325R-Insertion-15
[»] chr1 (1 HSPs)
chr1 (98-174)||(51458591-51458667)
[»] chr5 (1 HSPs)
chr5 (99-176)||(43162862-43162939)
[»] chr3 (1 HSPs)
chr3 (31-81)||(34899901-34899952)


Alignment Details
Target: chr1 (Bit Score: 65; Significance: 8e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 65; E-Value: 8e-29
Query Start/End: Original strand, 98 - 174
Target Start/End: Original strand, 51458591 - 51458667
Alignment:
Q  98 ttcctttaaagcaggtagaaccggcttagacaattttccattatctagttatagggatgcccctcatgaccatttac 174  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||    
T  51458591 ttcctttaaagcaggtagaaccggcttagacaattttccattatctagctctatggatgcccctcatgaccatttac 51458667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 43162862 - 43162939
Alignment:
Q  99 tcctttaaagcaggtagaaccggcttagacaattttccattatctagttatagggatgcccctcatgaccatttactt 176  Q
    |||||||||||||||| || | ||||||||||||||||||||||||| | || ||||||||||| ||| |||||||||    
T  43162862 tcctttaaagcaggtaaaatcagcttagacaattttccattatctagctctatggatgcccctcgtgatcatttactt 43162939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 34899952 - 34899901
Alignment:
Q  31 accaaaatttacctatatg-atagaaacacatctctctttagttcgtctctc 81  Q
    |||||| |||||||||||| ||| ||||||||||||||||||||| ||||||    
T  34899952 accaaactttacctatatgcatataaacacatctctctttagttcttctctc 34899901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University