View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13255_high_19 (Length: 226)

Name: NF13255_high_19
Description: NF13255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13255_high_19
NF13255_high_19
[»] chr7 (2 HSPs)
chr7 (19-208)||(32811950-32812135)
chr7 (139-202)||(32829599-32829662)


Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 32811950 - 32812135
Alignment:
Q  19 atagatagatattaaattccctggttgaaacgaaaatatattcaataatgtattaattgattcaaattaacattagttatacactagaaactaatgttat 118  Q
    |||||||||||| |||| ||||||||||||||||||||||||   |||||||||||||||||||||||||| ||||||||| ||||||||||||||||||    
T  32811950 atagatagatataaaat-ccctggttgaaacgaaaatatatt---taatgtattaattgattcaaattaactttagttatatactagaaactaatgttat 32812045  T
Q  119 tactgatttgctttgataggtaacatccttcaagtgtggtggtttcgcatttggcatcacaagaagccatgcagccattgatgggcatag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32812046 tactgatttgctttgataggtaacatccttcaagtgtggtggtttcgcatttggcatcacaagaagccatgcagccattgatgggcatag 32812135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 202
Target Start/End: Original strand, 32829599 - 32829662
Alignment:
Q  139 taacatccttcaagtgtggtggtttcgcatttggcatcacaagaagccatgcagccattgatgg 202  Q
    ||||||||||||||||||||||||||||  | ||| |||||| |||||||| | || |||||||    
T  32829599 taacatccttcaagtgtggtggtttcgctataggcttcacaacaagccatgtaacctttgatgg 32829662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University