View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13254_low_122 (Length: 226)

Name: NF13254_low_122
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13254_low_122
NF13254_low_122
[»] chr7 (1 HSPs)
chr7 (1-226)||(39944473-39944707)


Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 39944707 - 39944473
Alignment:
Q  1 tagaggattgaggcctggtgatgaatgtgtaatttcttgtgtaggatcattgtgtggtgatggtgattgtggatgttgaggctcattggttggtgaggga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39944707 tagaggattgaggcctggtgatgaatgtgtaatttcttgtgtaggatcattgtgtggtgatggtgattgtggatgttgaggctcattggttggtgaggga 39944608  T
Q  101 ttgtgagatggtggttgtgagggactgttgggtggtgaatgaattgttagttgtagaggatgactaatcggtgattg---------tacttgaggatcat 191  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||         ||||||||||||||    
T  39944607 ttgtgagatggtggttgtgagggactgttgggtggtgaatgatttgttagttgtagaggatgactaatcggtgattgtactagttgtacttgaggatcat 39944508  T
Q  192 ttattggtgaagattgtggtggttgtggagggtca 226  Q
    |||||||||||||||||||||||||||||||||||    
T  39944507 ttattggtgaagattgtggtggttgtggagggtca 39944473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University