View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13254_high_60 (Length: 371)

Name: NF13254_high_60
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13254_high_60
NF13254_high_60
[»] scaffold0189 (1 HSPs)
scaffold0189 (135-354)||(29329-29552)
[»] chr3 (1 HSPs)
chr3 (188-277)||(11053930-11054020)


Alignment Details
Target: scaffold0189 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: scaffold0189
Description:

Target: scaffold0189; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 135 - 354
Target Start/End: Original strand, 29329 - 29552
Alignment:
Q  135 ataccatttggccaagtcaaatcaaatcaaatctagtatatataatttttctcctttcaaatcaaaccttatggtgatataatttttcatgtctcctctt 234  Q
    ||||||||||||||||||||     |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||    
T  29329 ataccatttggccaagtcaa-----atcaaatccagtatatataatttttctcctttcaaatcaaaccttatggtgagataatttttcatgtctccactt 29423  T
Q  235 ttcctagtatacctctctagttgccttttgccatggtttgctt---------tgttccaggatgtggtttcttaaacaatgagtctttgttaacatatcc 325  Q
    |||||||| ||||||||||||||||||||||||||||||||||         ||||| ||||||||||||||||||||||||||||||||||||||||||    
T  29424 ttcctagtttacctctctagttgccttttgccatggtttgcttagtttattctgttctaggatgtggtttcttaaacaatgagtctttgttaacatatcc 29523  T
Q  326 gcggaatgcgcgggttgggaacaattacg 354  Q
    |||||||||||||||||||||||||||||    
T  29524 gcggaatgcgcgggttgggaacaattacg 29552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 277
Target Start/End: Original strand, 11053930 - 11054020
Alignment:
Q  188 ctttcaaatcaaaccttatggtgatataatttttcatgtctcctcttttcctagtatacct-ctctagttgccttttgccatggtttgctt 277  Q
    ||||||||| ||| ||||||||||  |||||||||||||||||||||| | | || ||||| |||| |||||||||||  |||||| ||||    
T  11053930 ctttcaaatgaaatcttatggtgaggtaatttttcatgtctcctctttgcttggtttacctcctctggttgccttttgatatggttcgctt 11054020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University