View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13253_low_45 (Length: 234)

Name: NF13253_low_45
Description: NF13253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13253_low_45
NF13253_low_45
[»] chr4 (1 HSPs)
chr4 (18-225)||(9358171-9358378)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 9358378 - 9358171
Alignment:
Q  18 ataatggaagactaattaataccttgcttgattatagtatttcagacgggataagcaattcactaacttcaactttctttggtttactctcatggccact 117  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  9358378 ataatggaagactaattaataccttgcttgattatagtatttctgacgggataagcaattcactaacttcaattttctttggtttactctcatggccact 9358279  T
Q  118 ttaagtcttctttttctaattctgcacactgatagactaacatcctttacatcttcaggttcttccaaatccaatacaatatggtcattacacgcattca 217  Q
     ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||    
T  9358278 ctaagtcttctttttctaattctgcatactgatagactaacatcctttacatcttcaggttcttccaaatccaagacaatatggtcattacatgcatcca 9358179  T
Q  218 tctcactc 225  Q
    | ||||||    
T  9358178 tgtcactc 9358171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University