View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1324_low_6 (Length: 441)

Name: NF1324_low_6
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1324_low_6
NF1324_low_6
[»] chr2 (1 HSPs)
chr2 (134-297)||(34479351-34479514)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 134 - 297
Target Start/End: Original strand, 34479351 - 34479514
Alignment:
Q  134 aatatttggtaggtttggactataaataagatgcatgcaggattggtgatgaatctgtgtgcagagcaacaatggcacgtgtgaagaactttaaggatan 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||      
T  34479351 aatatttggtaggtttggactataaataagatgcatgcaggattggtgatgaatctgtgtgcagagcaacaattgcacgtgtgaagaattttaaggattt 34479450  T
Q  234 nnnnnngttaaagtaaaatatattaataaccacattcttgcacaatataaagagagatcaataa 297  Q
          ||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||    
T  34479451 ttttttgttaaagtaaaatgtattaataaccacattcttgcataatataaacagagatcaataa 34479514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University