View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1324_low_18 (Length: 304)

Name: NF1324_low_18
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1324_low_18
NF1324_low_18
[»] chr8 (2 HSPs)
chr8 (141-289)||(31603397-31603542)
chr8 (30-148)||(31603237-31603355)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 141 - 289
Target Start/End: Original strand, 31603397 - 31603542
Alignment:
Q  141 tgagatgtataagaaaatggaacgaagaatcattggtcaaagcacaatagaaaaggatgctactcaggtcagccctgagactttgagtgtcatgggaaaa 240  Q
    |||| ||||||||||||| ||||| ||| |||||||||  |||||| ||| || |||||||||| ||||||| |||||||||  ||||||||||||||||    
T  31603397 tgagttgtataagaaaatagaacggagattcattggtcggagcacagtaggaa-ggatgctacttaggtcagtcctgagact--gagtgtcatgggaaaa 31603493  T
Q  241 gtaataaaatgatgtcgttctaactatttgaatattattctccttacat 289  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||||||    
T  31603494 gtaattaaatgacgtcgttctaactatttgaatattattctccttacat 31603542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 30 - 148
Target Start/End: Original strand, 31603237 - 31603355
Alignment:
Q  30 tatggatggcatcattacatgagcctttcagaatcagaggcgggtcaattaagccataacattcgcttgccacatggtggagacggggcaagagcagcat 129  Q
    ||||||||||||||| ||||||||||||||||||||||||||| |||| || ||||||| | | |||||||||||||||||||||||||||||||| ||     
T  31603237 tatggatggcatcatcacatgagcctttcagaatcagaggcggttcaactaggccataatagttgcttgccacatggtggagacggggcaagagcaacaa 31603336  T
Q  130 atgttgtcctatgagatgt 148  Q
    |||||||||||| ||||||    
T  31603337 atgttgtcctataagatgt 31603355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University