View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13248_high_16 (Length: 219)

Name: NF13248_high_16
Description: NF13248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13248_high_16
NF13248_high_16
[»] chr1 (1 HSPs)
chr1 (21-195)||(34014592-34014766)


Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 21 - 195
Target Start/End: Original strand, 34014592 - 34014766
Alignment:
Q  21 atgatagatgtgaagaactttaagctaattactccaaaatggggttacacttaaaaagaagtgcttaattagtgagaaagcaactttcatattcatgagt 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
T  34014592 atgatagatgtgaagaactttaagctaattactccaaaatggggttacacttaaaaagaagtgcttaattagtgagaaagtaacgttcatattcatgagt 34014691  T
Q  121 aaagtagatgagttatgcttatgcaagatatgtttagagcatatnnnnnnnntattcggatttcttttaacgggg 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||    
T  34014692 aaagtagatgagttatgcttatgcaagatatgtttagagcatataaaaaaaatattcggatttcttttaacgggg 34014766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University