View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13240_low_27 (Length: 212)

Name: NF13240_low_27
Description: NF13240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13240_low_27
NF13240_low_27
[»] chr8 (1 HSPs)
chr8 (15-165)||(4620736-4620886)


Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 165
Target Start/End: Original strand, 4620736 - 4620886
Alignment:
Q  15 gaaaagaaagagcagaaaacaaagaaacaaaacaatatctaacgatcatatacatacaatcgcttacgagtcgggacgatacgaaattgaagaaaaagaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4620736 gaaaagaaagagcagaaaacaaagaaacaaaacaatatctaacgatcatatacatacaatcgcttacgagtcgggacgatacgaaattgaagaaaaagaa 4620835  T
Q  115 agcttgccctggaaggaagagaaatattgtagagaggagcagattggttcc 165  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  4620836 agcttgccctggaaggaagagaaagattgtagagaggagcagattggttcc 4620886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University