View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13231_high_25 (Length: 236)

Name: NF13231_high_25
Description: NF13231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13231_high_25
NF13231_high_25
[»] chr8 (1 HSPs)
chr8 (19-222)||(3420325-3420528)
[»] chr7 (1 HSPs)
chr7 (24-64)||(18757702-18757742)


Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 3420528 - 3420325
Alignment:
Q  19 ctccttggaggaagaaccggtacatgcaaaacaagtggtttggaccttatcgtaggaccacgaacccggttcatggaaatccggttccagatgttgtttc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3420528 ctccttggaggaagaaccggtacatgcaaaacaagtggtttggaccttatcgtaggaccacgaacccggttcatggaaatccggttccagatgttgtttc 3420429  T
Q  119 ttctttcagtggcgttaaatgcagattagtcgggttcgacaacgccatgtccgagatcaaacatggcgtcgcctttgtcagaatcaaatgattgatagta 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3420428 ttctttcagtggcgttaaatgcagattagtcgggttcgacaacgccatgtccgagatcaaacatggcgtcgcctttgtcagaatcaaatgattgatagta 3420329  T
Q  219 gtat 222  Q
    ||||    
T  3420328 gtat 3420325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 18757742 - 18757702
Alignment:
Q  24 tggaggaagaaccggtacatgcaaaacaagtggtttggacc 64  Q
    |||||||||||||||| |||||| || ||||||||||||||    
T  18757742 tggaggaagaaccggttcatgcagaataagtggtttggacc 18757702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University