View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13228_low_7 (Length: 257)

Name: NF13228_low_7
Description: NF13228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13228_low_7
NF13228_low_7
[»] chr1 (1 HSPs)
chr1 (1-220)||(40508687-40508906)


Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 40508906 - 40508687
Alignment:
Q  1 tagacttcaccccatgaatggaagatggtgtaggaggacacccaacattaccacctacaggagtaggagatggtacatttataggtaccggagggttact 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||    
T  40508906 tagacttcaccccatgaatggaagatggtgtaggaggacacccaacattaccacctacaggagtaggagatggtacatttataggtgctggagggttact 40508807  T
Q  101 cgtgccaccactaggttgaggagcagaaccatttggtgataactgtggagatatctttggtacttgatgttgtggaggtgatgctgatggtgttggtgga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40508806 cgtgccaccactaggttgaggagcagaaccatttggtgataactgtggagatatctttggtacttgatgttgtggaggtgatgctgatggtgttggtgga 40508707  T
Q  201 ttttttgggggaatttgatg 220  Q
    |||| |||||||||||||||    
T  40508706 ttttgtgggggaatttgatg 40508687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University