View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13212_low_25 (Length: 278)

Name: NF13212_low_25
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13212_low_25
NF13212_low_25
[»] chr5 (2 HSPs)
chr5 (17-176)||(30088524-30088683)
chr5 (167-260)||(30096971-30097064)
[»] chr8 (1 HSPs)
chr8 (15-59)||(30394721-30394765)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 17 - 176
Target Start/End: Original strand, 30088524 - 30088683
Alignment:
Q  17 tttactagtcggttttgtaagattgatttagattcgatccaaattatacttatgtgtgtggatcaatttggtttaagttttttcacatctaattgtnnnn 116  Q
    ||||||| || |||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||        
T  30088524 tttactaatcagttttgtaaggttgacttagattcgatctaaattatacttatgtgtgtggatcaatttggtttaagttttttcacaactaattgtaaaa 30088623  T
Q  117 nnnnnnnngttgaatccgtcttgcaataataatgagtattctaattaatagtttctagta 176  Q
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  30088624 aactaaaagttgaatccgtcttgcaataataatgagtattctaattaatagtttcaagta 30088683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 167 - 260
Target Start/End: Original strand, 30096971 - 30097064
Alignment:
Q  167 gtttctagtatagaataagttgaaatatttaatctctgcaaggagtatttcacatcactttttatcctttccactaaacatgaatgcttctttt 260  Q
    ||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  30096971 gtttcaagtacagagtaagttgaaatatttaatctctgcaaggagtatttcacatcactttttatcctttccactaaatatgaatgcttctttt 30097064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 30394721 - 30394765
Alignment:
Q  15 actttactagtcggttttgtaagattgatttagattcgatccaaa 59  Q
    ||||||| ||||| |||||||||||||| |||||||| |||||||    
T  30394721 actttacaagtcgattttgtaagattgaattagattcaatccaaa 30394765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University