View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13212_low_19 (Length: 319)

Name: NF13212_low_19
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13212_low_19
NF13212_low_19
[»] chr5 (2 HSPs)
chr5 (76-164)||(15294328-15294414)
chr5 (224-291)||(15294254-15294321)


Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 76 - 164
Target Start/End: Complemental strand, 15294414 - 15294328
Alignment:
Q  76 tttaccaaactcaactgtcttcactctcgatttgtttttctaccataatatatgttccccttcctctgttgagagttgccgatatacaa 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
T  15294414 tttaccaaactcaactgtcttcactctcgatttgtttttctaccata--atatgttccccttcctctgttgagagttgccgatatacaa 15294328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 15294254 - 15294321
Alignment:
Q  224 ctttagacttggagttcatttttagtgcatgtttggctatatggcgatgtatgttcggtactgtagtg 291  Q
    |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||    
T  15294254 ctttagacttggagttcatttttagtgcatgtttggttatatggtgatgtatgttcggttctgtagtg 15294321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University