View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13212_high_36 (Length: 245)

Name: NF13212_high_36
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13212_high_36
NF13212_high_36
[»] chr2 (2 HSPs)
chr2 (181-228)||(6996673-6996720)
chr2 (85-139)||(6996762-6996815)


Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 181 - 228
Target Start/End: Complemental strand, 6996720 - 6996673
Alignment:
Q  181 tggctacatcttaacaaaggacacaaaccaagagcattagctaggaaa 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  6996720 tggctacatcttaacaaaggacacaaaccaagagcattagctaggaaa 6996673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 85 - 139
Target Start/End: Complemental strand, 6996815 - 6996762
Alignment:
Q  85 taagtaattagattaaagtactttgcttgtcaaataaacaaagattcgagtatac 139  Q
    |||||||||||||||| |||||| |||||||||||||||||||||||||||||||    
T  6996815 taagtaattagattaa-gtacttagcttgtcaaataaacaaagattcgagtatac 6996762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University