View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13203_high_33 (Length: 226)

Name: NF13203_high_33
Description: NF13203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13203_high_33
NF13203_high_33
[»] chr4 (3 HSPs)
chr4 (18-206)||(35044385-35044573)
chr4 (147-206)||(35036383-35036442)
chr4 (18-67)||(35036254-35036303)


Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 35044385 - 35044573
Alignment:
Q  18 atgaagaaatggtttggtgatatagcgataaacgtgatgtttagaacggtggttggagaacgttttgacggggaaggagaaaagaacaaacaaatacgaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35044385 atgaagaaatggtttggtgatatagcgataaacgtgatgtttagaacggtggttggagaacgttttgacggggaaggagaaaagaacaaacaaatacgaa 35044484  T
Q  118 aagcgtttagggagctcttccatctttgtggttcctttgttatatctgattcgttgccgtttttaagatggttggatttggatggaaaa 206  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35044485 aagcgtttagagagctcttccatctttgtggttcctttgttatatctgattcgttgccgtttttaagatggttggatttggatggaaaa 35044573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 206
Target Start/End: Original strand, 35036383 - 35036442
Alignment:
Q  147 ggttcctttgttatatctgattcgttgccgtttttaagatggttggatttggatggaaaa 206  Q
    ||||| ||||||||||||||   ||||| |||||| ||||||||||||||||||||||||    
T  35036383 ggttcatttgttatatctgacatgttgcggttttttagatggttggatttggatggaaaa 35036442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 35036254 - 35036303
Alignment:
Q  18 atgaagaaatggtttggtgatatagcgataaacgtgatgtttagaacggt 67  Q
    ||||| ||||||||||||||||||||||| ||||| |||| |||||||||    
T  35036254 atgaaaaaatggtttggtgatatagcgatgaacgttatgtgtagaacggt 35036303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University