View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13200_low_43 (Length: 243)

Name: NF13200_low_43
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13200_low_43
NF13200_low_43
[»] chr1 (5 HSPs)
chr1 (24-91)||(7499702-7499769)
chr1 (90-195)||(7488311-7488416)
chr1 (138-196)||(6943675-6943733)
chr1 (24-71)||(8139087-8139134)
chr1 (58-88)||(8139168-8139198)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 7499769 - 7499702
Alignment:
Q  24 gcactatctgttaatacatggctggctttagaatgatgtctcagttttttatgtttcttgatcatgaa 91  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||    
T  7499769 gcactatctgttaatacatggctggttttagaatgatgtctcagttttttatgtttctagatcatgaa 7499702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 90 - 195
Target Start/End: Complemental strand, 7488416 - 7488311
Alignment:
Q  90 aacatgtctgatagccatagtctcatgattctttataaaacaataccctatgtaacccttctctcatgtgacaacgtaacacacatcaaacccttctttt 189  Q
    |||||||||||||| | || ||||||||| ||| || |||||| |||||||||||| |||||||||||| ||| ||||| |||||||||| || ||||||    
T  7488416 aacatgtctgatagtcctaatctcatgatccttcatgaaacaaaaccctatgtaactcttctctcatgtcacaccgtaatacacatcaaatccctctttt 7488317  T
Q  190 ccaaca 195  Q
    ||||||    
T  7488316 ccaaca 7488311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 138 - 196
Target Start/End: Original strand, 6943675 - 6943733
Alignment:
Q  138 tatgtaacccttctctcatgtgacaacgtaacacacatcaaacccttcttttccaacaa 196  Q
    ||||||||||||||||||||||||||| ||| |||||||||| ||  ||||||||||||    
T  6943675 tatgtaacccttctctcatgtgacaacctaatacacatcaaatcccccttttccaacaa 6943733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 8139087 - 8139134
Alignment:
Q  24 gcactatctgttaatacatggctggctttagaatgatgtctcagtttt 71  Q
    |||||||| ||||||||||||||| |||| |||| |||||||||||||    
T  8139087 gcactatcagttaatacatggctgactttggaattatgtctcagtttt 8139134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 88
Target Start/End: Original strand, 8139168 - 8139198
Alignment:
Q  58 gatgtctcagttttttatgtttcttgatcat 88  Q
    |||||||||||||||||||||||||||||||    
T  8139168 gatgtctcagttttttatgtttcttgatcat 8139198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University