View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1319_low_72 (Length: 201)

Name: NF1319_low_72
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1319_low_72
NF1319_low_72
[»] chr7 (1 HSPs)
chr7 (1-96)||(47012235-47012330)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 47012235 - 47012330
Alignment:
Q  1 tataaaacgatattttctaaaatataaaagtcgagttatttatttgataaaaatgatggtgaatttattgatttattgaagcaaatatattattcg 96  Q
    |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
T  47012235 tataaaacgatattttttaaaatataaaaatcgagttatttatttgataaaaatgatggtgaatttattgattttttgaagcaaatatattgttcg 47012330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University