View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1319_low_56 (Length: 254)

Name: NF1319_low_56
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1319_low_56
NF1319_low_56
[»] chr7 (2 HSPs)
chr7 (103-226)||(44194209-44194333)
chr7 (50-78)||(44194360-44194388)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 103 - 226
Target Start/End: Complemental strand, 44194333 - 44194209
Alignment:
Q  103 agggcaagaatttttgccagaatgagttagcattgctactgactcttggatcactatgattcctctaaacgaccacc-ttgaatctagtaaaattctgca 201  Q
    ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||    
T  44194333 agggcaagaatttttgccagaatgagttagcattgttattgactcttggatcactatgattcatctaaacaaccacctttgaatctagtaaaattctgca 44194234  T
Q  202 tgttaaaagcaaaagatagcgtagt 226  Q
    |||||||||||||||||||||||||    
T  44194233 tgttaaaagcaaaagatagcgtagt 44194209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 78
Target Start/End: Complemental strand, 44194388 - 44194360
Alignment:
Q  50 tcagatattagaagtccaataaaaataat 78  Q
    |||||||||||||||||||||||||||||    
T  44194388 tcagatattagaagtccaataaaaataat 44194360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University