View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13185_low_6 (Length: 227)

Name: NF13185_low_6
Description: NF13185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13185_low_6
NF13185_low_6
[»] chr7 (1 HSPs)
chr7 (77-227)||(17175468-17175618)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 77 - 227
Target Start/End: Original strand, 17175468 - 17175618
Alignment:
Q  77 tcaagagatctaaggaaataaagaatggaagtccgtgactatctctnnnnnnnncatccctaagaaacaagggtaaataatccccccaaatattaatcaa 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||    
T  17175468 tcaagagatctaaggaaataaagaatggaagtccgtgactatctctaaaaaaaacatccctaagaaacaagggtaaataatccccccaaatattaatcaa 17175567  T
Q  177 aaacacttatggataaaacttatgtgcactggtatagacatcgtcactttt 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  17175568 aaacacttatggataaaacttatgtgcactggtatagacatcgtcattttt 17175618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University