View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1317_low_70 (Length: 226)

Name: NF1317_low_70
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1317_low_70
NF1317_low_70
[»] chr2 (1 HSPs)
chr2 (142-226)||(13023239-13023323)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 142 - 226
Target Start/End: Complemental strand, 13023323 - 13023239
Alignment:
Q  142 attggtttatcatcgtaacgattgctttccctataaatatgagaaacaatgaattccacttgaaaacataattgcaattagaaac 226  Q
    |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  13023323 attggtttatcatcgtaacgattgttttccctataaatataagaaacaatgaattccacttgaaaacataattgcaattagaaac 13023239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University