View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13179_low_3 (Length: 280)

Name: NF13179_low_3
Description: NF13179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13179_low_3
NF13179_low_3
[»] chr3 (1 HSPs)
chr3 (1-280)||(53616990-53617269)


Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 53617269 - 53616990
Alignment:
Q  1 aatgatgcgcttctaatattgcgtgacaaatatcttcccaacatttcccctgctgaaactcaacaccatcatccaattcaatctccggtaacatcgaatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53617269 aatgatgcgcttctaatattgcgtgacaaatatcttcccaacatttcccctgctgaaactcaacaccatcatccaattcaatctccggtaacatcgaatc 53617170  T
Q  101 cggaacgtgtgcatcttgatacagcgtcaccgatcctcctcgccgaaccggaaaatacgaatcctgaaccgcaaacctatcaggaccgggaataacgccg 200  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  53617169 tggaacgtgtgcatcttgatacagcgtcaccgatcctcctcgccgaaccggaaaatacgaatcctgaaccgcaaacctatcaggaccgggaataacaccg 53617070  T
Q  201 gaacgatacataggattttcatcgcatctcgtgaatttcatttcgagaaaaacagcgcaatcaggttttggaggtttacc 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53617069 gaacgatacataggattttcatcgcatctcgtgaatttcatttcgagaaaaacagcgcaatcaggttttggaggtttacc 53616990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University