View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13178_high_16 (Length: 227)

Name: NF13178_high_16
Description: NF13178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13178_high_16
NF13178_high_16
[»] chr5 (1 HSPs)
chr5 (12-211)||(42548179-42548366)


Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 12 - 211
Target Start/End: Complemental strand, 42548366 - 42548179
Alignment:
Q  12 gaagaatatgagactgagaaagaggtacgaaactgtaagaaggagaagaaaatgagtttactgatgaacagggtggttgagtcttccttcttcatcatct 111  Q
    ||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||    
T  42548366 gaagaatatgagactgagaaagaggtgagaaactgtaagaaggagaagaaaatgagtttactgatgaacagggtggttgaatcttccttcttcatcgtct 42548267  T
Q  112 aatctataagtcatcaattcactccactaaatgcaatttaatctaaacaaaacagataacaaaacacatctaagtttaattaattagaactagatactat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||| ||||||||||    
T  42548266 aatctataagtcatcaattcactccactaaatgcaatttaatctaaacaa------------aacacatctaagtttaattaattagaattagatactat 42548179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University