View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13151_low_1 (Length: 236)

Name: NF13151_low_1
Description: NF13151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13151_low_1
NF13151_low_1
[»] chr8 (1 HSPs)
chr8 (41-219)||(14933447-14933620)


Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 41 - 219
Target Start/End: Complemental strand, 14933620 - 14933447
Alignment:
Q  41 gtagtgagacttagaatcatgtcatgtactcatgtgtggtttgcatgcttcattactcaaatattggaactggattatctatgatcttattgttttttga 140  Q
    ||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  14933620 gtagtgagacttagaatcatgt-----actcatgtgtggtttgcatgcttcattactcaaatattggaactggattatctatgatcttattattttttga 14933526  T
Q  141 catgctttgtacttgatcttgtttaattggctgggaagtatttacaagtcttataatacctaaatgatagggcacatct 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14933525 catgctttgtacttgatcttgtttaattggctgggaagtatttacaagtcttataatacctaaatgatagggcacatct 14933447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University