View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1314_low_165 (Length: 229)

Name: NF1314_low_165
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1314_low_165
NF1314_low_165
[»] chr5 (1 HSPs)
chr5 (57-225)||(33054234-33054407)


Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 57 - 225
Target Start/End: Original strand, 33054234 - 33054407
Alignment:
Q  57 gatgaggaagaggtggcccatacaccagaatcacaaacatgacagtacac-----aacacaacagcctctcatactttcttcttcagcaatggtcatcac 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||    
T  33054234 gatgaggaagaggtggcccatacaccagaatcacaaacatgacagtacacaacacaacacaacagcctctcatactttcttcttcagcaatggtcatcac 33054333  T
Q  152 taccctgtctttcagatacatgggccccacttgcatgtgcattactctccgagttctccccattcatctcactc 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  33054334 taccctgtctttcagatacatgggccccacttgcatgtgcattactctccgagttctccccattcttctcactc 33054407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University