View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1314_low_114 (Length: 281)

Name: NF1314_low_114
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1314_low_114
NF1314_low_114
[»] chr8 (1 HSPs)
chr8 (30-221)||(31903994-31904185)
[»] chr6 (2 HSPs)
chr6 (55-89)||(9169437-9169471)
chr6 (55-89)||(33288154-33288188)
[»] chr2 (1 HSPs)
chr2 (55-89)||(17438156-17438190)


Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 30 - 221
Target Start/End: Original strand, 31903994 - 31904185
Alignment:
Q  30 aaaaggtaggttggtttggccaatcttctatgatgttgatccttctgatgtgcgaaagcagacgggatcatacagtgaagctttatctatgcttgcagaa 129  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||| ||||| ||| ||||||||||| ||||||||| |||     
T  31903994 aaaaggtaggttggtttggccaatcttttatgatgttgatccttctgatgtgaggaagcagacaggatcttacggtgaagctttagctatgcttggagag 31904093  T
Q  130 agattcaatgataataacttgcaaatatggaagaatgctttgcaacaagttgctaacttgtctggatggcatttcaaaattgggtaaatacc 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||    
T  31904094 agattcaatgataataacttgcaaatatggaagaatgctttgcaacaagtagctaacttgtctggatggcatttcaaaattgggtaactacc 31904185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 89
Target Start/End: Complemental strand, 9169471 - 9169437
Alignment:
Q  55 ttctatgatgttgatccttctgatgtgcgaaagca 89  Q
    ||||||||||||||||||||||| |||||||||||    
T  9169471 ttctatgatgttgatccttctgaggtgcgaaagca 9169437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 89
Target Start/End: Complemental strand, 33288188 - 33288154
Alignment:
Q  55 ttctatgatgttgatccttctgatgtgcgaaagca 89  Q
    ||||||||||||||||||||||| |||||||||||    
T  33288188 ttctatgatgttgatccttctgaggtgcgaaagca 33288154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 89
Target Start/End: Original strand, 17438156 - 17438190
Alignment:
Q  55 ttctatgatgttgatccttctgatgtgcgaaagca 89  Q
    ||||||||||||||||||||||| |||||||||||    
T  17438156 ttctatgatgttgatccttctgaggtgcgaaagca 17438190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University