View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13149_low_24 (Length: 216)

Name: NF13149_low_24
Description: NF13149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13149_low_24
NF13149_low_24
[»] chr1 (1 HSPs)
chr1 (64-216)||(2155799-2155951)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 64 - 216
Target Start/End: Original strand, 2155799 - 2155951
Alignment:
Q  64 ttttttgtgttcaaatttatatttacattttaaatgccatttcttgttagacaagccatatggagtaacagnnnnnnnngacatgtacttatggagtttt 163  Q
    |||||||||| |||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||        |||||||||||||||||||||    
T  2155799 ttttttgtgtccaaatttaaaattacattttaaatgccatttctagttagacaagccatatggagtaacagaaaaaaaagacatgtacttatggagtttt 2155898  T
Q  164 cttgcttacgtcggattgatgtataattgcatcatcatattatattcatgtat 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  2155899 cttgcttacgtcggattgatgtataattgcatcatcatattatattgatgtat 2155951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University