View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13138_low_42 (Length: 236)

Name: NF13138_low_42
Description: NF13138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13138_low_42
NF13138_low_42
[»] chr4 (2 HSPs)
chr4 (73-221)||(47626742-47626886)
chr4 (10-40)||(47627259-47627289)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 73 - 221
Target Start/End: Complemental strand, 47626886 - 47626742
Alignment:
Q  73 ctactcaatttactattggacctcactttagggaaataaaaaccccaaacccacgttttggcgcgaaagattgcttcattctctcgtttcttccaccact 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47626886 ctactcaatttactattggacctcactttagggaaataaaaaccccaaacccacgttttggcgcgaaagattgcttcattctctcgtttcttccaccact 47626787  T
Q  173 catcactactagggtttaatcaatcgttttgtaatctctgcaacaaaac 221  Q
    |||||||||||||||||    ||||||||||||||||||||||||||||    
T  47626786 catcactactagggttt----aatcgttttgtaatctctgcaacaaaac 47626742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 40
Target Start/End: Complemental strand, 47627289 - 47627259
Alignment:
Q  10 cacttcatatacgaaacaaatctaataatat 40  Q
    |||||||||||||||||||||||||||||||    
T  47627289 cacttcatatacgaaacaaatctaataatat 47627259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University