View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13135_low_1 (Length: 276)

Name: NF13135_low_1
Description: NF13135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13135_low_1
NF13135_low_1
[»] chr8 (1 HSPs)
chr8 (109-260)||(6929820-6929972)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 109 - 260
Target Start/End: Original strand, 6929820 - 6929972
Alignment:
Q  109 gggtggaaatttcttagttgtagggataacttcttttccaagttaccagtaactaaattaatgaatagagaaagatctccaaacaagctacacataaaaa 208  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6929820 gggtggaaattttttagttgtagggataacttcttttccaagttaccagtaactaaattaatgaatagagaaagatctccaaacaagctacacataaaaa 6929919  T
Q  209 ttgaaggatatgctaat-cctcatagtatagaagttaaacaatgcttcaccaa 260  Q
    ||||||||||||||||| |||| ||||||||||||||||||||||||||||||    
T  6929920 ttgaaggatatgctaatccctcgtagtatagaagttaaacaatgcttcaccaa 6929972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University