View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13133_high_29 (Length: 328)

Name: NF13133_high_29
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13133_high_29
NF13133_high_29
[»] chr4 (1 HSPs)
chr4 (19-315)||(41765298-41765594)


Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 315
Target Start/End: Original strand, 41765298 - 41765594
Alignment:
Q  19 ctttcctcccccgcgttaagatcaactcctccgttgaatattctgtcactgctggctccgatctctgtattgtcaccgccggtgcaagacagatcggtgg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41765298 ctttcctcccccgcgttaagatcaactcctccgttgaatattctgtcactgctggctccgatctctgtattgtcaccgccggtgcaagacagatcggtgg 41765397  T
Q  119 cgagtctaggcttaatcttcttcagaggaatctttctctgttcaaggcgattatacctcctttggctcgttactcgccggaaacggttctgatcatcgtg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41765398 cgagtctaggcttaatcttcttcagaggaatctttctctgttcaaggcgattatacctcctttggctcgttactcgccggaaacggttctgatcatcgtg 41765497  T
Q  219 tctaaccccgttgatgttcttacctatatcgcatggaagctttctgggtttccttctaatcgggtcatcgggtcgggtaccaatttggattcatctc 315  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41765498 tctaaccccgttgatgttcttacctatatcgcatggaagctttctgggtttccttctaatcgggtcatcgggtcgggtaccaatttggattcatctc 41765594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University