View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13130_low_7 (Length: 247)

Name: NF13130_low_7
Description: NF13130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13130_low_7
NF13130_low_7
[»] chr6 (3 HSPs)
chr6 (82-148)||(13476599-13476665)
chr6 (157-225)||(13476296-13476364)
chr6 (171-247)||(13930393-13930468)
[»] chr8 (1 HSPs)
chr8 (17-65)||(20809014-20809062)
[»] scaffold0060 (1 HSPs)
scaffold0060 (17-65)||(38016-38064)


Alignment Details
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 82 - 148
Target Start/End: Complemental strand, 13476665 - 13476599
Alignment:
Q  82 gattgtatttctacttaattgaatctttactttggaatatgaacttcacatcatgttaatttttgag 148  Q
    |||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||    
T  13476665 gattgtatttctacttaattgaatattttctttggaacatgaacttcacatcatgttaatttttgag 13476599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 157 - 225
Target Start/End: Complemental strand, 13476364 - 13476296
Alignment:
Q  157 cttacatagtgcggaaaaatgcaaagttgcagacagagtgcgaaaccaattattcattaatgatagatt 225  Q
    |||||| |||||  ||||||||||||||||||||||||||||||||||||| | |||||| ||||||||    
T  13476364 cttacaaagtgcaaaaaaatgcaaagttgcagacagagtgcgaaaccaattctacattaacgatagatt 13476296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 247
Target Start/End: Original strand, 13930393 - 13930468
Alignment:
Q  171 aaaaatgcaaagttgcagacagagtgcgaaaccaattattcattaatgatagattattacatgtgtgtgttatgttt 247  Q
    ||||||||||||||||| ||||||||| |||| |||| | |||||| ||||| || |||||||| ||||||| ||||    
T  13930393 aaaaatgcaaagttgcaaacagagtgcaaaacaaattctacattaacgataggttcttacatgt-tgtgttaagttt 13930468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 20809062 - 20809014
Alignment:
Q  17 acatcaaatataattcttgtctgagcaatagtgcactgactgacgagta 65  Q
    ||||||||||||||||   |||||| |||||||||||||||||||||||    
T  20809062 acatcaaatataattcccatctgagtaatagtgcactgactgacgagta 20809014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 38064 - 38016
Alignment:
Q  17 acatcaaatataattcttgtctgagcaatagtgcactgactgacgagta 65  Q
    |||||||||| ||||||  |||||| ||||| |||||||||||||||||    
T  38064 acatcaaataaaattctcatctgagtaatagcgcactgactgacgagta 38016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University