View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13125_low_35 (Length: 251)

Name: NF13125_low_35
Description: NF13125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13125_low_35
NF13125_low_35
[»] chr2 (1 HSPs)
chr2 (10-248)||(4923049-4923292)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 10 - 248
Target Start/End: Complemental strand, 4923292 - 4923049
Alignment:
Q  10 aagaatattgttgacaagtaatgtaaaaattgttgacaaggtaaccgctactcaatatccacattgttaataagaaaaatgcaataaatctgnnnnnnnn 109  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||            
T  4923292 aagaaaattgttgacaagtaatgtaaaaattgttgacaaggtaaccgctactcaatatgcacattgttaataagaaaaatgcaataaatctgcttcttct 4923193  T
Q  110 nn-----ccttctgaattttatgtaactaaataaattgaccaaccacaaattaaggaaaccacacaaataaactcactattaatttcatcgatgataaaa 204  Q
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  4923192 tttttttccttctgaattttatgtaactaaataaattgaccaaccacaaattaaggaaaccacacaaataaactcactattaatttcattgatgataaaa 4923093  T
Q  205 tgatcatcaatgttgtacaaggacacaatgcataacttcaaaaa 248  Q
    ||||||||||||||| |||||||||||||||||||||| |||||    
T  4923092 tgatcatcaatgttgcacaaggacacaatgcataacttaaaaaa 4923049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University