View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13116_low_22 (Length: 205)

Name: NF13116_low_22
Description: NF13116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13116_low_22
NF13116_low_22
[»] chr5 (1 HSPs)
chr5 (19-196)||(33269554-33269731)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 33269554 - 33269731
Alignment:
Q  19 gtgagaagtgagagatgggagaatgcgtttgagagttgggttgagagagtaatcagggttgggattgttgttgtggattgtgttgatggattctgagatt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33269554 gtgagaagtgagagatgggagaatgcgtttgagagttgggttgagagagtaatcagggttgggattgttgttgtggattgtgttgatggattctgagatt 33269653  T
Q  119 gtgtagaggatgtcatggtttttgtagtgaggttttgaagaaaatgagacaaggttgagatgaagatgaaaatgatga 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  33269654 gtgtagaggatgtcatggtttttgtagtgaggttttgaagaaaatgagacaaggttgtgatgaagatgaaaatgatga 33269731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University