View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13115_low_12 (Length: 259)

Name: NF13115_low_12
Description: NF13115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13115_low_12
NF13115_low_12
[»] chr5 (1 HSPs)
chr5 (60-178)||(1989161-1989279)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 60 - 178
Target Start/End: Original strand, 1989161 - 1989279
Alignment:
Q  60 tcagcatatgtatagccaccaaaacctacggctactggtaaggtatgttgtaacagatatcaacaccatttcttgataccctttactctctttctagcat 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  1989161 tcagcatatgtatagccaccaaaacctacggctactggtaaggtatgttgtaacagatatcaacaccatttcttgataccctttactctctttctatcat 1989260  T
Q  160 ttgtcacttcaaaatttga 178  Q
    |||||||||||||||||||    
T  1989261 ttgtcacttcaaaatttga 1989279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University