View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1310_low_35 (Length: 274)

Name: NF1310_low_35
Description: NF1310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1310_low_35
NF1310_low_35
[»] scaffold0002 (2 HSPs)
scaffold0002 (174-274)||(336052-336152)
scaffold0002 (53-119)||(335931-335997)


Alignment Details
Target: scaffold0002 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 174 - 274
Target Start/End: Original strand, 336052 - 336152
Alignment:
Q  174 atgttatgagattggctctaggctatagttgcttttgtgaggtaaaaatttggtagcttttttcttctaacgacacaacaaacctactgttttgttttca 273  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  336052 atgttatgagattggctctaggctatagtttcttttgtgaggtaaaaatttggtaggttttttcttctaacgacacaacaaacctactgttttgttttca 336151  T
Q  274 t 274  Q
    |    
T  336152 t 336152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 53 - 119
Target Start/End: Original strand, 335931 - 335997
Alignment:
Q  53 aatagtagatcttattattcctgatcgtgctattaatcaaacttactaaaactttcttgtgttgcta 119  Q
    |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||    
T  335931 aatagtagatcttattattcctgatcgtgctattaatcaaacctacaaaaactttcttgtgttgcta 335997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University