View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13108_low_41 (Length: 229)

Name: NF13108_low_41
Description: NF13108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13108_low_41
NF13108_low_41
[»] chr3 (1 HSPs)
chr3 (25-223)||(35394034-35394232)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 35394232 - 35394034
Alignment:
Q  25 gaaatgtgagagtgaatgagtgagaatactttttgacaagcagagattggatgatgaaccataggttgtccagctaatggaaagagtggtttaggaatgt 124  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  35394232 gaaatgtgagagtgaacgagtgagaatactttttgacaagcagagattggatgatgaaccattggttgtccagctaatggaaagagtggtttaggaatgt 35394133  T
Q  125 tgaatgataatggacggaatcgagtgcctttggtgggtcctccaaccatgataaccgccacaactctctcttctgcaatccccatattcttcgacatcc 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||    
T  35394132 tgaatgataatggacggaatcgagtgcctttggtgggtcctccaaccatgataaccgccacaactctctcttctgcaatccccatcttattcgagatcc 35394034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University