View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13091_low_12 (Length: 282)

Name: NF13091_low_12
Description: NF13091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13091_low_12
NF13091_low_12
[»] chr2 (2 HSPs)
chr2 (106-282)||(1158258-1158434)
chr2 (13-41)||(1158452-1158480)


Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 106 - 282
Target Start/End: Complemental strand, 1158434 - 1158258
Alignment:
Q  106 atcaacatctccttttctttcctctttcactcgttaattcacaccaaacaatatatttaatgtactcccccttgacatctttttctttcttcccaccttc 205  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  1158434 atcaacatctctttttctttcctctttcactcgttaattcacatcaaacaatatatttaatgtactcccccttgacatctttttctttcttcccaccatc 1158335  T
Q  206 atcatctatcctcactttattctcacaatcaaacattaacatagtaaagtatactagataacgagtgtcatgactct 282  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1158334 atcatccatcctcactttattctcacaatcaaacattaacatagtaaagtatactagataacgagtgtcatgactct 1158258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 1158480 - 1158452
Alignment:
Q  13 aatatactagccgggtcaattggatgaag 41  Q
    |||||||||||||||||||||||||||||    
T  1158480 aatatactagccgggtcaattggatgaag 1158452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University