View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13082_low_12 (Length: 235)

Name: NF13082_low_12
Description: NF13082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13082_low_12
NF13082_low_12
[»] chr2 (2 HSPs)
chr2 (6-148)||(38076422-38076564)
chr2 (164-199)||(38076387-38076422)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 38076564 - 38076422
Alignment:
Q  6 tggagaaataaaccagaccttgaaagctacatgagacttgcatgtgtttttaattgtgattgcactcctaacttgcttaccaggttcatcttcaaaacaa 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38076564 tggagaaataaaccagaccttgaaagctacatgagacttgcatgtgtttttaattgtgattgcactcctaacttgcttaccaggttcatcttcaaaacaa 38076465  T
Q  106 aaccacacattaatcagagtcagtttgcaaaaatctcctaatc 148  Q
    |||||||||||||||||||||||||| ||||||||||||||||    
T  38076464 aaccacacattaatcagagtcagtttacaaaaatctcctaatc 38076422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 199
Target Start/End: Complemental strand, 38076422 - 38076387
Alignment:
Q  164 caaattaatcgattcttgggctagatatcgagtttc 199  Q
    ||||||||||||||||||||||||||||||||||||    
T  38076422 caaattaatcgattcttgggctagatatcgagtttc 38076387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University