View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1307_high_17 (Length: 370)

Name: NF1307_high_17
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1307_high_17
NF1307_high_17
[»] chr8 (2 HSPs)
chr8 (109-305)||(38370914-38371107)
chr8 (323-362)||(38370876-38370915)


Alignment Details
Target: chr8 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 109 - 305
Target Start/End: Complemental strand, 38371107 - 38370914
Alignment:
Q  109 caatctatgttgtgttggtatttgaatgatagtttattagtattactgttgccgattgccattagttacttcaatgtttgtttgtttgggttacatgata 208  Q
    |||||||||||||||||||||||||||||||||||||||   ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||    
T  38371107 caatctatgttgtgttggtatttgaatgatagtttatta---ttactgttgccgattgcgattagttacttgaatgtttgtttgtttgggttacatgata 38371011  T
Q  209 ttggtacaaagtttccaccaccgctcagcagtgggtaatctttttagagaatagagaatacgtgggacacacaaggtgcgttctcctctgtcaactg 305  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38371010 ttggtacaaagtttccagcaccgctcagcagtgggtaatctttttagagaatagagaatacgtgggacacacaaggtgcgttctcctctgtcaactg 38370914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 323 - 362
Target Start/End: Complemental strand, 38370915 - 38370876
Alignment:
Q  323 tgagccgggaaccgaaccacatgcttaaaatggtccaaat 362  Q
    |||||||||||||||||||||||||||||| |||||||||    
T  38370915 tgagccgggaaccgaaccacatgcttaaaagggtccaaat 38370876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University