View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13070_low_23 (Length: 230)

Name: NF13070_low_23
Description: NF13070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13070_low_23
NF13070_low_23
[»] chr1 (1 HSPs)
chr1 (84-209)||(39612697-39612822)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 84 - 209
Target Start/End: Original strand, 39612697 - 39612822
Alignment:
Q  84 taggtgctgtatatcttccttaaaacagcttccctatgacaaaggacagtgcggtcagactgtaatataccatgcaaggtgtcaatagataatgtgctat 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39612697 taggtgctgtatatcttccttaaaacagcttccctatgacaaaggacagtgcggtcagactgtaatataccatgcaaggtgtcaatagataatgtgctat 39612796  T
Q  184 aacatgaaaaatttattattgtatgt 209  Q
    ||||||||| ||||||||||||||||    
T  39612797 aacatgaaacatttattattgtatgt 39612822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University