View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1306_low_36 (Length: 271)

Name: NF1306_low_36
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1306_low_36
NF1306_low_36
[»] chr2 (1 HSPs)
chr2 (1-114)||(19172246-19172359)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 19172359 - 19172246
Alignment:
Q  1 ttcttgacgacgaagacaatgaaaccgaaaccaatgataattcatcggtttcaatgtcttctgatcgtccatggcaaatagccatggcatggaggaatcc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  19172359 ttcttgacgacgaagacaatgaaaccgaaaccaatgataattcatcggtttcaatgtcttctgatcgtccatggcaaatagccatggcgtggaggaatcc 19172260  T
Q  101 atcagaaaccctaa 114  Q
    ||||||||||||||    
T  19172259 atcagaaaccctaa 19172246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University