View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_high_77 (Length: 267)

Name: NF1305_high_77
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_high_77
NF1305_high_77
[»] chr3 (1 HSPs)
chr3 (29-222)||(34975708-34975901)


Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 222
Target Start/End: Complemental strand, 34975901 - 34975708
Alignment:
Q  29 taggcctattgacttcatgatggaaagtaagttagaaggcataattgggagtagttctaggaattttgataattattttggaaatagtgatcatatgaat 128  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34975901 taggcctattgacttcatgatggaaaataagttagaaggcataattgggagtagttctaggaattttgataattattttggaaatagtgatcatatgaat 34975802  T
Q  129 atgaatatgggtgttgggattggaggagatatgatgaatggacaaaatgggttgccacagaattttcatcatgcatttggtggaatgtcatttg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34975801 atgaatatgggtgttgggattggaggagatatgatgaatggacaaaatgggttgccacagaattttcatcatgcatttggtggaatgtcatttg 34975708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University