View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_high_67 (Length: 298)

Name: NF1305_high_67
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_high_67
NF1305_high_67
[»] chr5 (1 HSPs)
chr5 (1-241)||(30356206-30356446)


Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 30356206 - 30356446
Alignment:
Q  1 tatgacaaggcaatcacctctccatttttgttctcaagaagggggatattaggaaaagaccttggattaattggaataccattatctacctaggcaagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30356206 tatgacaaggcaatcacctctccatttttgttctcaagaagggggatattaggaaaagaccttggattaattggaataccattatctacctaggcaagga 30356305  T
Q  101 gaacatatgtttaggggtgtacaaattgcgggaatttattttagctttgttaggaagatgatgttggagggtttgtgttgaacatgatagtttgtgactg 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  30356306 gaacatatgtttaggggtgtacaaattgcgggaatttaatttagctttgttaggaagatgacgttggagggtttgtgttgaacatgatagtttgtgactg 30356405  T
Q  201 aaggagggaggatgagggaggctgggcgtggtgagtctgtg 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  30356406 aaggagggaggatgagggaggctgggcgtggtgagtctgtg 30356446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University